Sequence: (R-Ahx-R)3-IKILFQN-RRMKWKKC
| Experiment Id | EXP001247 |
|---|---|
| Paper | Improved cell-penetrating peptide–PNA conjugates for splicing redirection in HeLa cells and exon ski |
| Peptide | Pip1–PNADMD |
| Delivery Success Class | no |
| In Vivo Flag | no |
| Uptake Confirmed | no |
| Label Confidence | medium |
| In Vitro Functional Effect | yes |
| Endosomal Escape Evidence | |
| Peptide Concentration | |
| Rna Concentration | |
| Mixing Ratio | |
| Formulation Format | covalent peptide–PNA conjugate (disulfide or thioether linkage) |
| Formulation Components | Differentiated H2K mdx mouse myotubes; conjugates incubated 4 h in OptiMEM then media change; RT-PCR exon skipping readout (no added transfection agent). PNA cargo: GGCCAAACCTCGGCTTACCT (PNADMD, 20-mer; targets dystrophin exon 23 region in mdx). Conjugation via stable thioether linkage to PNADMD (as described). |
| Size Nm | |
| Zeta Mv | |
| Model Scope | in_vitro |
| Model Type | in vitro |
| Cell Lines Or Primary Cells | H2K mdx mouse myotubes (differentiated) |
| Animal Model | |
| Administration Route | |
| Output Type | exon skipping (RT-PCR; qualitative) |
| Output Value | |
| Output Units | |
| Output Notes | Small exon skipping at 2 µM; weaker than Pip2a/Pip2b. |
| Toxicity Notes | |
| Curation Notes |