Back to browse

EXP001250

Paper

Improved cell-penetrating peptide–PNA conjugates for splicing redirection in HeLa cells and exon skipping in mdx mouse muscle (2008)

Peptide

RXR4–PNADMD

Sequence: (R-Ahx-R)4-C

RNA

SCO

All experiment fields

Experiment Id EXP001250
Paper Improved cell-penetrating peptide–PNA conjugates for splicing redirection in HeLa cells and exon ski
Peptide RXR4–PNADMD
Delivery Success Class no
In Vivo Flag no
Uptake Confirmed no
Label Confidence medium
In Vitro Functional Effect yes
Endosomal Escape Evidence
Peptide Concentration
Rna Concentration
Mixing Ratio
Formulation Format covalent peptide–PNA conjugate (disulfide or thioether linkage)
Formulation Components Differentiated H2K mdx mouse myotubes; conjugates incubated 4 h in OptiMEM then media change; RT-PCR exon skipping readout (no added transfection agent). PNA cargo: GGCCAAACCTCGGCTTACCT (PNADMD, 20-mer; targets dystrophin exon 23 region in mdx). Conjugation via stable thioether linkage to PNADMD (as described).
Size Nm
Zeta Mv
Model Scope in_vitro
Model Type in vitro
Cell Lines Or Primary Cells H2K mdx mouse myotubes (differentiated)
Animal Model
Administration Route
Output Type exon skipping (RT-PCR; qualitative)
Output Value
Output Units
Output Notes Small exon skipping at 2 µM; weaker than Pip2a/Pip2b.
Toxicity Notes
Curation Notes