pAntp / Penetratin (Antennapedia 43–58)
Sequence: RQIKIWFQNRRMKWKK
| Experiment Id | EXP001633 |
|---|---|
| Paper | Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv |
| Peptide | pAntp / Penetratin (Antennapedia 43–58) |
| Delivery Success Class | no |
| In Vivo Flag | no |
| Uptake Confirmed | yes |
| Label Confidence | high |
| In Vitro Functional Effect | yes |
| Endosomal Escape Evidence | |
| Peptide Concentration | ~0.3–3 µM construct for binding assays (36 h) |
| Rna Concentration | ~0.3–3 µM construct for binding assays (36 h) |
| Mixing Ratio | |
| Formulation Format | Covalent CPP–PNA conjugate (disulfide-linked) |
| Formulation Components | Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA. |
| Size Nm | |
| Zeta Mv | |
| Model Scope | in_vitro |
| Model Type | in vitro |
| Cell Lines Or Primary Cells | Bowes melanoma cells |
| Animal Model | |
| Administration Route | |
| Output Type | in vitro functional antisense (receptor binding, low potency) |
| Output Value | Decreased 125I-galanin binding with substantially lower potency; EC50 ~1.9 µM (Table 1). |
| Output Units | |
| Output Notes | Bowes binding assay (36 h incubation). PNA sequence: ATGGAGCTGGCCTGCGGTCGGA (target human GalR1 mRNA). |
| Toxicity Notes | |
| Curation Notes |