Back to browse

EXP001634

Paper

Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in vivo (1998)

Peptide

Transportan

Sequence: GWTLNSAGYLLGKINLKALAALAKKIL

RNA

ASO

All experiment fields

Experiment Id EXP001634
Paper Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv
Peptide Transportan
Delivery Success Class no
In Vivo Flag no
Uptake Confirmed yes
Label Confidence high
In Vitro Functional Effect no
Endosomal Escape Evidence
Peptide Concentration Up to 3 µM tested; EC50 extrapolated >100 µM
Rna Concentration Up to 3 µM tested; EC50 extrapolated >100 µM
Mixing Ratio
Formulation Format Covalent CPP–PNA conjugate (disulfide-linked)
Formulation Components Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA.
Size Nm
Zeta Mv
Model Scope in_vitro
Model Type in vitro
Cell Lines Or Primary Cells Bowes melanoma cells
Animal Model
Administration Route
Output Type in vitro negative control
Output Value No meaningful reduction in 125I-galanin binding (EC50 >100 µM; Table 1) vs antisense constructs.
Output Units
Output Notes Used as specificity control in binding assays and in vivo experiments. PNA sequence: GGCCATGGCTGCTCTCCCGTCTG (target human GalR1 mRNA).
Toxicity Notes
Curation Notes