Back to browse

EXP001637

Paper

Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in vivo (1998)

Peptide

Transportan

Sequence: GWTLNSAGYLLGKINLKALAALAKKIL

RNA

ASO

All experiment fields

Experiment Id EXP001637
Paper Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv
Peptide Transportan
Delivery Success Class yes
In Vivo Flag yes
Uptake Confirmed no
Label Confidence high
In Vitro Functional Effect
Endosomal Escape Evidence
Peptide Concentration 150 µM in 10 µL per injection (3 injections/36 h)
Rna Concentration 150 µM in 10 µL per injection (3 injections/36 h)
Mixing Ratio
Formulation Format Covalent CPP–PNA conjugate (disulfide-linked)
Formulation Components Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA.
Size Nm
Zeta Mv
Model Scope in_vivo
Model Type in vivo
Cell Lines Or Primary Cells
Animal Model Rat (spinal cord dorsal horn; reflex facilitation model)
Administration Route Intrathecal
Output Type in vivo functional pain modulation
Output Value Attenuated electrophysiologic effect consistent with reduced GalR1 function in vivo (reflex facilitation assay).
Output Units
Output Notes Intrathecal injections as above; compared to scrambled controls. PNA sequence: CCATTCCCTTCACTGAGGTTC (target rat GalR1 mRNA).
Toxicity Notes
Curation Notes