Back to browse

EXP001639

Paper

Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in vivo (1998)

Peptide

pAntp / Penetratin (Antennapedia 43–58)

Sequence: RQIKIWFQNRRMKWKK

RNA

ASO

All experiment fields

Experiment Id EXP001639
Paper Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv
Peptide pAntp / Penetratin (Antennapedia 43–58)
Delivery Success Class no
In Vivo Flag yes
Uptake Confirmed no
Label Confidence high
In Vitro Functional Effect
Endosomal Escape Evidence
Peptide Concentration 150 µM in 10 µL per injection (3 injections/36 h)
Rna Concentration 150 µM in 10 µL per injection (3 injections/36 h)
Mixing Ratio
Formulation Format Covalent CPP–PNA conjugate (disulfide-linked)
Formulation Components Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA.
Size Nm
Zeta Mv
Model Scope in_vivo
Model Type in vivo
Cell Lines Or Primary Cells
Animal Model Rat
Administration Route Intrathecal
Output Type in vivo negative/low effect
Output Value No attenuation of 125I-galanin binding reported for r(1–21) construct in spinal cord autoradiography compared with saline; limited in vivo effect relative to r(18–38).
Output Units
Output Notes Autoradiography experiments indicate lack of binding attenuation for translation-start targeting construct. PNA sequence: ATGGAACTGCCTGCCCGGTGAAC (target rat GalR1 mRNA).
Toxicity Notes
Curation Notes