Sequence: (R-Ahx-R)3-IdKILFQN-dRRMKWHKBC
| Experiment Id | EXP001340 |
|---|---|
| Paper | Improved cell-penetrating peptide–PNA conjugates for splicing redirection in HeLa cells and exon ski |
| Peptide | Pip2a–PNADMD |
| Delivery Success Class | yes |
| In Vivo Flag | yes |
| Uptake Confirmed | no |
| Label Confidence | medium |
| In Vitro Functional Effect | |
| Endosomal Escape Evidence | |
| Peptide Concentration | |
| Rna Concentration | |
| Mixing Ratio | |
| Formulation Format | covalent peptide–PNA conjugate (disulfide or thioether linkage) |
| Formulation Components | mdx mice (6–8 weeks); intramuscular injection into tibialis anterior (TA): 5 µg conjugate in 40 µL saline; endpoints at 2 weeks: dystrophin immunohistochemistry + RT-PCR exon 23 skipping. PNA cargo: GGCCAAACCTCGGCTTACCT (PNADMD, 20-mer; targets dystrophin exon 23 region in mdx). |
| Size Nm | |
| Zeta Mv | |
| Model Scope | in_vivo |
| Model Type | in vivo |
| Cell Lines Or Primary Cells | |
| Animal Model | mdx mouse (TA muscle, local i.m. injection) |
| Administration Route | |
| Output Type | dystrophin restoration (IHC) + exon skipping (RT-PCR) |
| Output Value | |
| Output Units | |
| Output Notes | Marked increase in dystrophin-positive fibers; ~3-fold higher vs naked PNADMD and RXR4–PNADMD per abstract. |
| Toxicity Notes | |
| Curation Notes |