Back to browse

EXP001342

Paper

Improved cell-penetrating peptide–PNA conjugates for splicing redirection in HeLa cells and exon skipping in mdx mouse muscle (2008)

Peptide

RXR4–PNADMD

Sequence: (R-Ahx-R)4-C

RNA

PNA (steric-blocking)

All experiment fields

Experiment Id EXP001342
Paper Improved cell-penetrating peptide–PNA conjugates for splicing redirection in HeLa cells and exon ski
Peptide RXR4–PNADMD
Delivery Success Class yes
In Vivo Flag yes
Uptake Confirmed no
Label Confidence medium
In Vitro Functional Effect
Endosomal Escape Evidence
Peptide Concentration
Rna Concentration
Mixing Ratio
Formulation Format covalent peptide–PNA conjugate (disulfide or thioether linkage)
Formulation Components mdx mice (6–8 weeks); intramuscular injection into tibialis anterior (TA): 5 µg conjugate in 40 µL saline; endpoints at 2 weeks: dystrophin immunohistochemistry + RT-PCR exon 23 skipping. PNA cargo: GGCCAAACCTCGGCTTACCT (PNADMD, 20-mer; targets dystrophin exon 23 region in mdx).
Size Nm
Zeta Mv
Model Scope in_vivo
Model Type in vivo
Cell Lines Or Primary Cells
Animal Model mdx mouse (TA muscle, local i.m. injection)
Administration Route
Output Type dystrophin restoration (IHC) + exon skipping (RT-PCR)
Output Value
Output Units
Output Notes Improves vs naked PNADMD but lower than Pip2a/Pip2b (immunohistochemistry).
Toxicity Notes
Curation Notes