Back to browse

EXP001759

Paper

Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in vivo (1998)

Peptide

Transportan

Sequence: GWTLNSAGYLLGKINLKALAALAKKIL

RNA

PNA (peptide nucleic acid; antisense)

All experiment fields

Experiment Id EXP001759
Paper Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv
Peptide Transportan
Delivery Success Class no
In Vivo Flag no
Uptake Confirmed yes
Label Confidence high
In Vitro Functional Effect yes
Endosomal Escape Evidence
Peptide Concentration 0.1–3 µM construct for binding assays (36 h); imaging used 1 µM for 4 h; biotinyl-transportan 10 µM 30 min
Rna Concentration 0.1–3 µM construct for binding assays (36 h); imaging used 1 µM for 4 h; biotinyl-transportan 10 µM 30 min
Mixing Ratio
Formulation Format Covalent CPP–PNA conjugate (disulfide-linked)
Formulation Components Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA.
Size Nm
Zeta Mv
Model Scope in_vitro
Model Type in vitro
Cell Lines Or Primary Cells Bowes melanoma cells (human); Rin m5F (rat insulinoma) mentioned for receptor half-life estimate
Animal Model
Administration Route
Output Type in vitro functional antisense (receptor binding + protein downregulation)
Output Value Decreased 125I-galanin binding to Bowes cell membranes; EC50 ~0.20 µM for h(18–38) conjugate (Table 1). Immunoprecipitation shows reduced GalR1 protein vs scrambled control.
Output Units
Output Notes Cells incubated with constructs at 37°C (typically 36 h for binding assays; 24 h for metabolic labeling/IP). Confocal shows internalization and broad cytosolic distribution with some nuclear accumulation; transportan localizes mainly to membranous structures. PNA sequence: GCCGTGCCCTCGCTGAGTTCCC (target human GalR1 mRNA).
Toxicity Notes
Curation Notes