Back to browse

EXP001761

Paper

Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in vivo (1998)

Peptide

Transportan

Sequence: GWTLNSAGYLLGKINLKALAALAKKIL

RNA

PNA (peptide nucleic acid; antisense)

All experiment fields

Experiment Id EXP001761
Paper Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv
Peptide Transportan
Delivery Success Class no
In Vivo Flag no
Uptake Confirmed yes
Label Confidence high
In Vitro Functional Effect yes
Endosomal Escape Evidence
Peptide Concentration ~0.3–3 µM construct for binding assays (36 h)
Rna Concentration ~0.3–3 µM construct for binding assays (36 h)
Mixing Ratio
Formulation Format Covalent CPP–PNA conjugate (disulfide-linked)
Formulation Components Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA.
Size Nm
Zeta Mv
Model Scope in_vitro
Model Type in vitro
Cell Lines Or Primary Cells Bowes melanoma cells
Animal Model
Administration Route
Output Type in vitro functional antisense (receptor binding, lower potency)
Output Value Decreased 125I-galanin binding with lower potency; EC50 ~0.6 µM for h(1–21) conjugate (Table 1).
Output Units
Output Notes Same Bowes assay conditions; authors discuss target secondary structure impacting potency. PNA sequence: ATGGAGCTGGCCTGCGGTCGGA (target human GalR1 mRNA).
Toxicity Notes
Curation Notes