Sequence: GWTLNSAGYLLGKINLKALAALAKKIL
PNA (peptide nucleic acid; antisense)
| Experiment Id | EXP001763 |
|---|---|
| Paper | Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv |
| Peptide | Transportan |
| Delivery Success Class | no |
| In Vivo Flag | no |
| Uptake Confirmed | yes |
| Label Confidence | high |
| In Vitro Functional Effect | no |
| Endosomal Escape Evidence | |
| Peptide Concentration | Up to 3 µM tested; EC50 extrapolated >100 µM |
| Rna Concentration | Up to 3 µM tested; EC50 extrapolated >100 µM |
| Mixing Ratio | |
| Formulation Format | Covalent CPP–PNA conjugate (disulfide-linked) |
| Formulation Components | Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA. |
| Size Nm | |
| Zeta Mv | |
| Model Scope | in_vitro |
| Model Type | in vitro |
| Cell Lines Or Primary Cells | Bowes melanoma cells |
| Animal Model | |
| Administration Route | |
| Output Type | in vitro negative control |
| Output Value | No meaningful reduction in 125I-galanin binding (EC50 >100 µM; Table 1) vs antisense constructs. |
| Output Units | |
| Output Notes | Used as specificity control in binding assays and in vivo experiments. PNA sequence: GGCCATGGCTGCTCTCCCGTCTG (target human GalR1 mRNA). |
| Toxicity Notes | |
| Curation Notes |