Back to browse

EXP001764

Paper

Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in vivo (1998)

Peptide

pAntp / Penetratin (Antennapedia 43–58)

Sequence: RQIKIWFQNRRMKWKK

RNA

PNA (peptide nucleic acid; antisense)

All experiment fields

Experiment Id EXP001764
Paper Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv
Peptide pAntp / Penetratin (Antennapedia 43–58)
Delivery Success Class no
In Vivo Flag no
Uptake Confirmed yes
Label Confidence high
In Vitro Functional Effect no
Endosomal Escape Evidence
Peptide Concentration Up to 3 µM tested; EC50 extrapolated >100 µM
Rna Concentration Up to 3 µM tested; EC50 extrapolated >100 µM
Mixing Ratio
Formulation Format Covalent CPP–PNA conjugate (disulfide-linked)
Formulation Components Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA.
Size Nm
Zeta Mv
Model Scope in_vitro
Model Type in vitro
Cell Lines Or Primary Cells Bowes melanoma cells
Animal Model
Administration Route
Output Type in vitro negative control
Output Value No meaningful reduction in 125I-galanin binding (EC50 >100 µM; Table 1).
Output Units
Output Notes Specificity control. PNA sequence: GGCCATGGCTGCTCTCCCGTCTG (target human GalR1 mRNA).
Toxicity Notes
Curation Notes