Back to browse

EXP001765

Paper

Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in vivo (1998)

Peptide

pAntp / Penetratin (Antennapedia 43–58)

Sequence: RQIKIWFQNRRMKWKK

RNA

PNA (peptide nucleic acid; antisense)

All experiment fields

Experiment Id EXP001765
Paper Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv
Peptide pAntp / Penetratin (Antennapedia 43–58)
Delivery Success Class yes
In Vivo Flag yes
Uptake Confirmed no
Label Confidence high
In Vitro Functional Effect
Endosomal Escape Evidence
Peptide Concentration 150 µM in 10 µL per injection (3 injections/36 h); autoradiography incubation 100 µM
Rna Concentration 150 µM in 10 µL per injection (3 injections/36 h); autoradiography incubation 100 µM
Mixing Ratio
Formulation Format Covalent CPP–PNA conjugate (disulfide-linked)
Formulation Components Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA.
Size Nm
Zeta Mv
Model Scope in_vivo
Model Type in vivo
Cell Lines Or Primary Cells
Animal Model Rat (intrathecal delivery to spinal cord dorsal horn); nociceptive flexor reflex EMG recorded
Administration Route Intrathecal (spinal catheter)
Output Type in vivo functional receptor downregulation + pain modulation
Output Value Reduced spinal cord 125I-galanin binding (~40% decrease reported) and attenuated galanin’s inhibition of C-fiber–induced reflex facilitation, indicating functional suppression of GalR1 in vivo.
Output Units
Output Notes Three intrathecal injections over 36 h (10 µL at 150 µM) via implanted catheters; electrophysiology ~12 h after last injection. Autoradiography performed with 100 µM cPNA r(18–38)-pAntp incubation of spinal sections. PNA sequence: CCATTCCCTTCACTGAGGTTC (target rat GalR1 mRNA).
Toxicity Notes
Curation Notes