Back to browse

PMO (antisense oligonucleotide)

Linked experiment: EXP001280

Linked peptide: B peptide

Linked paper: Cell-penetrating peptide-conjugated antisense oligonucleotides restore systemic muscle and cardiac dystrophin expression and function (2008)

RNA fields

RNA Type
PMO (antisense oligonucleotide)
RNA Payload Or Target
Dystrophin exon 23 splice donor (mdx mouse) – exon skipping to restore reading frame
RNA Modifications
25mer phosphorodiamidate morpholino oligomer (PMO; sequence M23D: GGCCAAACCTCGGCTTACCTGAAAT)