pAntp / Penetratin (Antennapedia 43–58)
Sequence: RQIKIWFQNRRMKWKK
| Experiment Id | EXP001636 |
|---|---|
| Paper | Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv |
| Peptide | pAntp / Penetratin (Antennapedia 43–58) |
| Delivery Success Class | yes |
| In Vivo Flag | yes |
| Uptake Confirmed | no |
| Label Confidence | high |
| In Vitro Functional Effect | |
| Endosomal Escape Evidence | |
| Peptide Concentration | 150 µM in 10 µL per injection (3 injections/36 h); autoradiography incubation 100 µM |
| Rna Concentration | 150 µM in 10 µL per injection (3 injections/36 h); autoradiography incubation 100 µM |
| Mixing Ratio | |
| Formulation Format | Covalent CPP–PNA conjugate (disulfide-linked) |
| Formulation Components | Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA. |
| Size Nm | |
| Zeta Mv | |
| Model Scope | in_vivo |
| Model Type | in vivo |
| Cell Lines Or Primary Cells | |
| Animal Model | Rat (intrathecal delivery to spinal cord dorsal horn); nociceptive flexor reflex EMG recorded |
| Administration Route | Intrathecal (spinal catheter) |
| Output Type | in vivo functional receptor downregulation + pain modulation |
| Output Value | Reduced spinal cord 125I-galanin binding (~40% decrease reported) and attenuated galanin’s inhibition of C-fiber–induced reflex facilitation, indicating functional suppression of GalR1 in vivo. |
| Output Units | |
| Output Notes | Three intrathecal injections over 36 h (10 µL at 150 µM) via implanted catheters; electrophysiology ~12 h after last injection. Autoradiography performed with 100 µM cPNA r(18–38)-pAntp incubation of spinal sections. PNA sequence: CCATTCCCTTCACTGAGGTTC (target rat GalR1 mRNA). |
| Toxicity Notes | |
| Curation Notes |