pAntp / Penetratin (Antennapedia 43–58)
Sequence: RQIKIWFQNRRMKWKK
| Experiment Id | EXP001638 |
|---|---|
| Paper | Cell penetrating PNA constructs regulate galanin receptor levels and modify pain transmission in viv |
| Peptide | pAntp / Penetratin (Antennapedia 43–58) |
| Delivery Success Class | no |
| In Vivo Flag | yes |
| Uptake Confirmed | no |
| Label Confidence | high |
| In Vitro Functional Effect | |
| Endosomal Escape Evidence | |
| Peptide Concentration | 150 µM in 10 µL per injection (3 injections/36 h) |
| Rna Concentration | 150 µM in 10 µL per injection (3 injections/36 h) |
| Mixing Ratio | |
| Formulation Format | Covalent CPP–PNA conjugate (disulfide-linked) |
| Formulation Components | Carrier peptide (transportan or pAntp/penetratin) linked to cysteine-extended 21-mer PNA via disulfide bond; intracellular reduction releases PNA. |
| Size Nm | |
| Zeta Mv | |
| Model Scope | in_vivo |
| Model Type | in vivo |
| Cell Lines Or Primary Cells | |
| Animal Model | Rat |
| Administration Route | Intrathecal |
| Output Type | in vivo negative control |
| Output Value | No reduction in galanin binding / no attenuation of galanin effect on reflex facilitation compared with untreated controls. |
| Output Units | |
| Output Notes | Used as control in reflex facilitation experiments. PNA sequence: GGCCATGGCTGCTCTCCCGTCTG (target rat GalR1 mRNA). |
| Toxicity Notes | |
| Curation Notes |