Back to browse

shRNA plasmid (DNA vector)

Linked experiment: EXP001537

Linked peptide: Penetratin (PEN)

Linked paper: Intracellular delivery of antiviral shRNA using penetratin-based complexes effectively inhibits respiratory syncytial virus replication and host cell apoptosis (2024)

RNA fields

RNA Type
shRNA plasmid (DNA vector)
RNA Payload Or Target
pGFP-V-RS (OriGene) plasmid encoding RSV F-gene shRNA (U6 promoter) and GFP marker (CMV promoter); shRNA targets RSV fusion (F) gene; shRNA sequence: GCAGTGCAGTCAGCAAAGGCTATCTTAGTTCAAGAGGCACTAAGATAGCCTTTGCTGACTGCACTGC (F-shRNA cassette; includes BamHI/HindIII sites)
RNA Modifications
Plasmid DNA vector; GFP reporter marker