Back to browse

shRNA plasmid (DNA vector)

Linked experiment: EXP001539

Linked peptide: Penetratin (PEN)

Linked paper: Intracellular delivery of antiviral shRNA using penetratin-based complexes effectively inhibits respiratory syncytial virus replication and host cell apoptosis (2024)

RNA fields

RNA Type

shRNA plasmid (DNA vector)

RNA Payload Or Target

pGFP-V-RS (OriGene) plasmid encoding RSV F-gene shRNA (U6 promoter) and GFP marker (CMV promoter); shRNA targets RSV fusion (F) gene; shRNA sequence: GCAGTGCAGTCAGCAAAGGCTATCTTAGTTCAAGAGGCACTAAGATAGCCTTTGCTGACTGCACTGC (F-shRNA cassette; includes BamHI/HindIII sites)

RNA Modifications

Plasmid DNA vector; GFP marker